Help with the chemistry/biology of aging?

[Aurelene]

I need some help regarding aging. What exactly causes the body to age? I've heard that generally speaking, the oxygen the body needs to break down its food also breaks down the body and organs as well. Assuming it would be possible (via magic or technology) to continuously perform redox equations, could the wear and tear on the body associated with aging be stopped? Or in the reverse, if more oxygen was utilized by the body, would that increase the body's wear and tear?

I was thinking of how it would be possible for a race such as elves to not age over time, and if they had an extra brain structure that reversed the damage of oxygen on their systems unconsciously, would that eliminate an aging problem, or am I grasping at straws?

Thank you for taking the time to read this!

 

[Benjamin Clayborne]

There's a lot of related mechanisms. The main mechanism we evolved is that organisms have evolved to deliberately break down over time, so as to eliminate older copies of the genes. There's no reason that an organism couldn't be constructed so as to be eternal, and able to repair any normal damage that occurs over time. All it needs is raw materials and periodic infusions of energy (that is, food). (If humanity as a species survives long enough, eventually we'll figure out how to genetically engineer ourselves to do this.)

Maybe elves are immortal because they didn't evolve self-destruction mechanisms, so barring violent trauma or some sort of fatal disease or parasite, they'll normally continue living indefinitely.

 

[Penpilot]

Check these pages out
Telomeres and Aging - Understanding Cellular Aging
Telomere - Wikipedia, the free encyclopedia

Telomeres have to do with cell division. To my understanding, each time a cell divides it's telomeres shorten. If they can stop the shortening of telomeres they think we'd stop ageing.

Something interesting that you might be able to use. There exists an immortal Jellyfish. Turritopsis nutricula - Wikipedia, the free encyclopedia

Hopefully this helps a little.

 

[ascanius]

molecular oxygen is the final electron acceptor in respiration. What you are talking about is free radicals, O2, which from my understanding also break down the bonds between proteins and other organic molecules.

Telomeres or TATTA box, in think it's TATTA or TATATA something like that, is the final sequence of base pairs Adenine and Thymine. And your right Penpilot after each cellular replication the telomere ends shorten. The telomeres serve as a buffer at the end that so genetic information is not lost once DNA polymerase reaches the end. The nature of how replication works means that if I have a length say. TCATTTCAGAAGTCAATATATATATATATATA The polymerase will stop at the final T in the sequence and terminate replication at that spot. This means that final A is lost. If however the telomeres have shortened to a nothing as in TCATTTCAGAAGTCAA The polymerase stops at the second to last A, and the last one is lost. This is what I remember without looking though my books. Last I heard the telomeres are also thought to be a cause of cancer, I don't remember the details of that though.

Another thing that causes aging is the eventual decay of the cellular machinery. The molecules in the cell are not static but always changing unless stabilized by double or triple bonds. This means that even in large complex proteins they are vibrating in a fixed conformation, never truly static by the definition of the word. Occasionally these proteins can denature if conditions are right, to hot, specific enzymes, free radicals. The way I think of it is the cell is in constant equilibrium between replenishment and decay of it's proteins. Specific random collisions cause a protein to become non functional then due to feedback inhibition and other cellular regulators more protein is made to keep product formation continuous. As time passes the cellular machinery decays beyond the ability of the cell to replenish. At least this is my understanding.
Another interesting thing that is related to age specific diseases are prions, or virulent proteins. This is believed to be the cause of Alzheimer. A protein folds improperly, or spontaneously, then this protein comes in contact with it's functional protein causing it to fold improperly and so on. The whole thing with the proteins is mostly caused by external sources, bad diet, exposure to toxic chemicals, UV radiation to an extent. Basically everything is in a constant state of decay and replenishment, as time passes the bodies ability to replenish fall behind the rate of decay.

 

[gavintonks]

Thew ancients believed it was a gene that was switched off in humans, aging is related to an enzyme stored in the body which we have a capacity to produce once the capacity is reached it is leached from the muscles, that why people loose their muscles and become enfeebled.

The core is around the stomach and intestines as you are what you eat and your capacity to process food, your intestines become clogged and less effective. The next process is uptake into the blood vessels which only have the capacity to service 80% of the body so certain areas are on cycles so through damage and clogging less nutrients get to these area.The final is from the blood to tissue which you need vitamin c for, so if the body is healthy and the uptake to tissue is dysfunctional you start a downward spiral as well.If it was just air we could have oxygen in our homes.

 

[gavintonks]

another thing is the ability to replace worn out cells, the brain replaces cells in 26 year cycles so if you cannot replace damaged cells, and those that cannot reproduce or undergo mitosis then you are also on a slippery slope

 

[JCFarnham]

As far as I (or we I suppose) know, "immortal" creatures that keep the same version of their genetic material don't strictly exist. In the case of that Jellyfish that was mentioned, I believe the theory is that it spontaneously reverts to a previous version of itself... how ever that happens.

Another interesting factoid is some lobsters (may have been some thing similar I can't remember). It has been observed that a "lobster" that has recently shed it shell is in fact, for all intents and purposes, like a younger version of itself underneath. It has also been observed that this capability appears to be endless as the animals does this to grow larger throughout its life until death. A controversial theory goes that since this process tends not to break down the "lobster" could continue to shed, replenish and grow, and given the right conditions perhaps sustain this indefinitely. This would of course mean that some where in the deepest trenchs of the ocean are some huge and ridiculously old shellfish... weird and scary thought.

The theory persists because an "old" lobster hasn't ever really been documented. We couldn't date them in part thanks to the fact that their body is only as old as the last time it shed.

(Even if that lobster paragraph is bollocks, though Stephen Fry has led me to believe otherwise, its a lovely thought and is perfect Fantasy fodder I'm sure you'll all agree haha)

 

[gavintonks]

was a delightful story of a person who used 300 year old khoi / carp fish guts to create an immortality drug

 

[gavintonks]

ethelyene is the pythos snake that is meant to switch on or off longevity / immortality

 

[Aurelene]

Looks like I've got quite a lot of research ahead of me! Thank you all for helping me out with this, and I'll definitely have to devote some time researching each of the different theories posted and try to find a cohesive and realistic theory I could develop.

This really is such a useful site, and again, thank you all for you input!

 

[gavintonks]

The workings behind the hulk is that he regenerates with star fish genes so he is not technically immortal he just regenerates.so like a lizard growing a new tail or a star fish a limb, the mechanism would be in the thalmus gland which would produce a enzyme or protein marker that will switch all cells to regenerate and replace the old, the liver is the only regenerative organ in the body, you can clone a new liver from cells, the key is
1 - age as cells develop and mutate until fully grown
we start with 2 and end up with billions with thousands of different functions
2 - the elasticity of muscle would require consideration
3 - the ability of cells to transfer information like memory as they are replaced
4 - the storage of chemicals hat are required to continue the conversions / remember we eat a lettuce and it becomes toe nails as an example
5 - the retaining of the adult shape over that period so you would need a 'energy' template of sorts that the body would copy to ensure continuation of that entity, as you also have the diversity, as each unit is individualistic [see cloning, where the new clone is not an identical copy only a genetic copy] so the influences that make the individual unique would require a pattern that is sustainable
6 - then reproductive capability an its impact on the species
If the switches come on and off a the wrong times, a person could be an adolescent for much longer for instance
good luck with the research its a good topic

 

[Ivan]

molecular oxygen is the final electron acceptor in respiration. What you are talking about is free radicals, O2, which from my understanding also break down the bonds between proteins and other organic molecules.

Radical reactions are particularly damaging because they are self-perpetuating until they hit something that absorbs the radical without producing another one. I believe anti-oxidants do this absorbing.

 

[SeverinR]

There is a train of thought that high oxygen helps healing and reduces aging. Hyperbaric treatments, or high concentrations of oxygen in a pressurized enviroment help heal and reduce aging.
room air is 20-21% oxygen.

 

[Ivan]

What do you mean by "heal and reduce aging"? There are definitely immediate benefits to higher oxygen exposure, especially for those with serious illnesses affecting respiratory or vascular systems; and higher barometric pressure can help open wounds. Are these what you are talking about?